Information on Accepted Sequences

There are 3 possibilities to enter your sequence.

1. Just write or cut/paste your sequence into the field. 
   In this case, all numbers and spaces are removed, and all
   characters except c, g, u, a, and t are automatically converted
   to n.

2. You can write or cut/paste your sequence in the FASTA-Format. 
   The name of your sequence will then be extracted out of your entry.

3. You can write or cut/paste a whole series of sequences in the
   FASTA-Format into the field. Just write the sequences one after another.

FASTA-Format:
    
>Your sequence id
ccgcgcggcguauaucgcgcgcguagcgagcgagcucgagc
ccguuagcggagcggaucgcgcggcgagaaauaauagcgcg